2. Search Result
Search Result
Results for "

RNA oligonucleotide

" in MedChemExpress (MCE) Product Catalog:

38

Inhibitors & Agonists

3

Fluorescent Dye

2

Biochemical Assay Reagents

1

Natural
Products

Targets Recommended:
Cat. No. Product Name Target Research Areas Chemical Structure
  • HY-160230
    ssRNA41 sodium

    		Toll-like Receptor (TLR) Infection
    ssRNA41 sodium is a 20-mer phosphothioate protected single-stranded RNA oligonucleotide. It derives from ssRNA40 by replacement of all U nucleotides with adenosine. ssRNA41 sodium is unable to induce the production of type IFNs, and therefore can be used as a negative control for ssRNA40 .
    ssRNA41 sodium
  • HY-157091
    Uridine, 5'-P,P',P'',P''-tetrahydrogen imidotriphosphate

    		Others Others
    Uridine, 5'-(P,P',P'',P''-tetrahydrogen imidotriphosphate) is a non-hydrolyzable nucleotide that can synthesize RNA oligonucleotides .
    Uridine, 5'-P,P',P'',P''-tetrahydrogen imidotriphosphate
  • HY-D1408
    DMTr-4'-Me-U-CED-TBDMS phosphoramidite

    DMTr-4'-Methyluridine-CED-TBDMS phosphoramidite

    		 DNA Stain Cardiovascular Disease
    DMTr-4'-Me-U-CED-TBDMS phosphoramidite (DMTr-4'-Methyluridine-CED-TBDMS phosphoramidite), a dye reagent for oligonucleotide labeling, can be used for the research of applications in RNA therapeutics, RNA aptamers, and ribozymes for elucidating RNA structure. DMTr-4'-Me-U-CED-TBDMS phosphoramidite represents a probe with wide utility for elucidation of RNA structure .
    DMTr-4'-Me-U-CED-TBDMS phosphoramidite
  • HY-D1409
    DMTr-4'-F-U-CED-TBDMS phosphoramidite

    DMTr-4'-F-uridine-CED-TBDMS phosphoramidite

    		 DNA Stain Cardiovascular Disease
    DMTr-4'-F-U-CED-TBDMS phosphoramidite (DMTr-4'-F-uridine-CED-TBDMS phosphoramidite), a dye reagent for oligonucleotide labeling, can be used for the research of applications in RNA therapeutics, RNA aptamers, and ribozymes for elucidating RNA structure. DMTr-4'-F-U-CED-TBDMS phosphoramidite represents a probe with wide utility for elucidation of RNA structure .
    DMTr-4'-F-U-CED-TBDMS phosphoramidite
  • HY-160231
    ssRNA42 sodium

    		Toll-like Receptor (TLR) Inflammation/Immunology
    ssRNA42 (sodium) is a 20-mer phosphothioate protected single-stranded RNA oligonucleotide. ssRNA42 (sodium) derives from ssRNA40 by replacement of all G nucleotides with adenosine. ssRNA42 activated human PBMCs to secrete IFN-α, TNF-a, IL- 12p40, and IL-6, but ssRNA42 failed to stimulated murine pDCs and PBMCs.
    ssRNA42 sodium
  • HY-139099
    Diguanosine 5′-triphosphate

    Gp3G

    		 Nucleoside Antimetabolite/Analog DNA/RNA Synthesis Cancer
    Diguanosine 5′-triphosphate (Gp3G) is a dinucleoside triphosphates. Diguanosine 5′-triphosphate also is a virus-specific oligonucleotide. Diguanosine 5′-triphosphate is needed for the synthesis of RNA during the transcription process .
    Diguanosine 5′-triphosphate
  • HY-139099A
    Diguanosine 5′-triphosphate lithium

    Gp3G lithium

    		 DNA/RNA Synthesis Nucleoside Antimetabolite/Analog Cancer
    Diguanosine 5′-triphosphate (Gp3G) lithium is a dinucleoside triphosphates. Diguanosine 5′-triphosphate lithium also is a virus-specific oligonucleotide. Diguanosine 5′-triphosphate lithium is needed for the synthesis of RNA during the transcription process .
    Diguanosine 5′-triphosphate lithium
  • HY-D1411
    DMTr-4'-CF3-5-Me-U-CED phosphoramidite

    DMTr-4'-CF3-5-Methyluridine-CED phosphoramidite

    		 DNA Stain Others
    DMTr-4'-CF3-5-Me-U-CED phosphoramidite (DMTr-4'-CF3-5-Methyluridine-CED phosphoramidite), the modified oligodeoxynucleotide (ODN), is a dye reagent for oligonucleotide labeling, can be used for the research of applications in RNA research .
    DMTr-4'-CF3-5-Me-U-CED phosphoramidite
  • HY-21997
    DMT-2'fluoro-da(bz) amidite

    		DNA/RNA Synthesis Others
    Dmt-2'fluoro-da(bz) amidite, an uniformly modified 2'-deoxy-2'-fluoro phosphorothioate oligonucleotide, is a nuclease-resistant antisense compound with high affinity and specificity for RNA targets. Dmt-2'fluoro-da(bz) amidite is also an intermediate for 5’-DMT-3’-phosphoramidite synthesis .
    DMT-2'fluoro-da(bz) amidite
  • HY-D0093
    Ethidium homodimer

    EthD-1

    		 DNA Stain Others
    Ethidium homodimer (EthD-1) is a high-affinity fluorescent nucleic acid dye commonly used to stain mammals, bacteria, yeast, and fungi. Ethidium homodimer binds to DNA or RNA, enhancing fluorescence more than 30 times. The Ethidium homodimer has a strong positive charge, so it cannot cross cell membranes and stain living cells; But the Ethidium homodimer can cross the disordered region of the dead cell membrane to reach the nucleus and embed the DNA double strand to produce red fluorescence. Therefore, Ethidium homodimer is a relatively sensitive nucleic acid stain that can accurately detect nucleic acids in solution or in decomposing cells. Ethidium homodimer binds DNA, Ex/Em=528/617 nm .
    Ethidium homodimer
  • HY-153324
    PS220 sodium

    		Others Others
    PS220 (sodium) is an antisense RNA oligonucleotides. PS220 (sodium) can be used for research of treating muscular dystrophy .
    PS220 sodium
  • HY-147412A
    Ultevursen sodium

    QR-421a sodium

    		 Others Others
    Ultevursen sodium is a single-stranded RNA based oligonucleotide that is designed to skip exon 13 in the RNA with the aim to stop vision loss in people that have retinitis pigmentosa due to a mutation in exon 13 of the USH2A gene (encoding usherin).
    Ultevursen sodium
  • HY-153836
    Anivamersen

    		Others Others
    Anivamersen is an RNA aptamer to reverse the anticoagulant effect of the parenteral factor IXa inhibitor pegnivacogin. REG1 is a novel anticoagulation system consisting of pegnivacogin, an RNA aptamer inhibitor of coagulation factor IXa, and anivamersen, a complementary sequence reversal oligonucleotide.
    Anivamersen
  • HY-153836A
    Anivamersen sodium

    		Others Others
    Anivamersen sodium is an RNA aptamer to reverse the anticoagulant effect of the parenteral factor IXa inhibitor pegnivacogin. REG1 is a novel anticoagulation system consisting of pegnivacogin, an RNA aptamer inhibitor of coagulation factor IXa, and anivamersen, a complementary sequence reversal oligonucleotide.
    Anivamersen sodium
  • HY-147217
    Bepirovirsen

    ISIS 505358

    		 HBV Infection
    Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .
    Bepirovirsen
  • HY-147217A
    Bepirovirsen sodium

    ISIS 505358 sodium

    		 HBV Infection
    Bepirovirsen sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC) .
    Bepirovirsen sodium
  • HY-112980
    Nusinersen

    		DNA/RNA Synthesis Inflammation/Immunology
    Nusinersen is an antisense oligonucleotide agent that modifies pre–messenger RNA splicing of the SMN2 gene and thus promotes increased production of full-length SMN protein .
    Nusinersen
  • HY-112980A
    Nusinersen sodium

    		DNA/RNA Synthesis Inflammation/Immunology
    Nusinersen sodium is an antisense oligonucleotide agent that modifies pre–messenger RNA splicing of the SMN2 gene and thus promotes increased production of full-length SMN protein .
    Nusinersen sodium
  • HY-153496
    Sepofarsen

    QR 110

    		 Others Others
    Sepofarsen (QR-110) is an RNA antisense oligonucleotide targeting to the p.Cys998X mutation (also known as the c.2991+1655A>G mutation) in the CEP290 gene.
    Sepofarsen
  • HY-153496A
    Sepofarsen sodium

    QR 110 sodium

    		 Others Others
    Sepofarsen (QR-110) sodium is an RNA antisense oligonucleotide targeting to the p.Cys998X mutation (also known as the c.2991+1655A>G mutation) in the CEP290 gene.
    Sepofarsen sodium
  • HY-145998
    2′-O-Methyl-8-methyl guanosine

    m8Gm

    		 Others Others
    2′-O-Methyl-8-methyl guanosine (m8Gm) is a Z-form RNA stabilizer. 2′-O-Methyl-8-methyl guanosine can markedly stabilize the Z-RNA at low salt conditions . m8Gm-contained oligonucleotides stabilize the Z-DNA under low salt conditions .
    2′-O-Methyl-8-methyl guanosine
  • HY-145982
    m7GpppCmpG

    		Nucleoside Antimetabolite/Analog Others
    m7GpppCmpG, an oligonucleotide, is an M 7GpppNpG trinucleotide cap analogue. m7GpppCmpG can be used as a chemical tool enabling manufacturing of RNA featuring either cap 0 or cap 1 structures .
    m7GpppCmpG
  • HY-145981
    m7GpppCpG

    		Nucleoside Antimetabolite/Analog Others
    m7GpppCpG, an oligonucleotide, is an M 7GpppNpG trinucleotide cap analogue. m7GpppCpG can be used as a chemical tool enabling manufacturing of RNA featuring either cap 0 or cap 1 structures .
    m7GpppCpG
  • HY-145979
    m7GpppUmpG

    		Nucleoside Antimetabolite/Analog Others
    m7GpppUmpG, an oligonucleotide, is an M 7GpppNpG trinucleotide cap analogue. m7GpppUmpG can be used as a chemical tool enabling manufacturing of RNA featuring either cap 0 or cap 1 structures .
    m7GpppUmpG
  • HY-145980
    m7GpppUpG

    		Nucleoside Antimetabolite/Analog Others
    m7GpppUpG, an oligonucleotide, is an M 7GpppNpG trinucleotide cap analogue. m7GpppUpG can be used as a chemical tool enabling manufacturing of RNA featuring either cap 0 or cap 1 structures .
    m7GpppUpG
  • HY-148828
    LSP-GR3

    		iGluR
    LSP-GR3 is a novel chemically-modified RNA oligonucleotides, called splice modulating oligomers (SMOs), which potently and specifically modulate GluR alternative splicing to GluR3-flip expression throughout the CNS.
    LSP-GR3
  • HY-148828A
    LSP-GR3 sodium

    		iGluR Neurological Disease
    LSP-GR3 sodium is a novel chemically-modified RNA oligonucleotides, called splice modulating oligomers (SMOs), which potently and specifically modulate GluR alternative splicing to GluR3-flip expression throughout the CNS.
    LSP-GR3 sodium
  • HY-160229
    ssRNA40 sodium

    		Toll-like Receptor (TLR) Infection
    ssRNA40 (sodium) is a 20-mer phosphothioate protected single-stranded RNA oligonucleotide. ssRNA40 is a uridine-rich ssRNA derived from the HIV-1 long terminal repeat on activation of NK cells via TLR7/8 [1][2].
    ssRNA40 sodium
  • HY-132608
    Inotersen sodium

    ISIS-420915 sodium

    		 Transthyretin (TTR) Neurological Disease
    Inotersen (ISIS-420915) sodium is a 2′-O-methoxyethyl-modified antisense oligonucleotide. Inotersen sodium inhibits the production of transthyretin (TTR) protein by targeting the TTR RNA transcript and reduces the levels of the TTR transcript. Inotersen sodium can be used for the research of hereditary TTR amyloidosis polyneuropathy .
    Inotersen sodium
  • HY-148100
    Emapticap pegol

    NOX-E36

    		 Others Inflammation/Immunology Cancer
    Emapticap pegol is a inhibitor of pro-inflammatory chemokine C-C motif-ligand 2 (CCL2). Emapticap pegol is a 40-nucleotide oligonucleotide aptamer, displays different Spiegelmers (L-RNA aptamer) isform in human (NOX-E36) and mouse (mNOX-E36) .
    Emapticap pegol
  • HY-148100A
    Emapticap pegol sodium

    NOX-E36 sodium

    		 Others Cancer
    Emapticap pegol sodium is a inhibitor of pro-inflammatory chemokine C-C motif-ligand 2 (CCL2). Emapticap pegol sodium is a 40-nucleotide oligonucleotide aptamer, displays different Spiegelmers (L-RNA aptamer) isform in human (NOX-E36) and mouse (mNOX-E36) .
    Emapticap pegol sodium
  • HY-B0956
    Paromomycin sulfate
    1 Publications Verification

    Aminosidine sulfate

    		 Antibiotic Parasite Bacterial Infection
    Paromomycin (Aminosidine) sulfate, a neomycin (HY-B0470) derivative, is a broad spectrum aminoglycoside antibiotic with amebicidal and bactericidal effects. Paromomycin sulfate prematures termination of translation of mRNA and inhibits protein synthesis by specifically binds to the RNA oligonucleotide at the A site of bacterial 30S ribosomes. Paromomycin sulfate can be used for the research of bacterial and parasitic infections .
    Paromomycin sulfate
  • HY-138577
    2'-F-Bz-dC Phosphoramidite

    		DNA/RNA Synthesis Nucleoside Antimetabolite/Analog Others
    2'-F-Bz-dC Phosphoramidite can be used in the synthesis of oligoribonucleotide (such as DNA and RNA). 2'-F-Bz-dC Phosphoramidite also used for synthesis antiviral agent to inhibit the replication of virus. 2'-F-Bz-dC Phosphoramidite contains a phosphorothioate backbone, to synthesise antisense oligonucleotide analogs to induce apoptosis in cancer cells .
    2'-F-Bz-dC Phosphoramidite
  • HY-W570888
    2'-O,4'-C-Methylenecytidine

    LNA-C(Bz)

    		 Nucleoside Antimetabolite/Analog Cancer
    2'-O,4'-C-Methylenecytidine (LNA-C(Bz)) is a bicyclic nucleoside analogue with fixed N-type conformation. 2'-O,4'-C-Methylenecytidine can be used to synthesize oligonucleotides. 2'-O,4'-C-Methylenecytidine forms duplexes with complementary DNA and RNA strands .
    2'-O,4'-C-Methylenecytidine
  • HY-P0229
    Ribonulease T1, Aspergillus oryzae

    RNAse T1

    		 DNA/RNA Synthesis Others
    Ribonulease T1, Aspergillus oryzae (Rnase T1), is commonly used in biochemical research. Ribonuclease T1 is an endonuclease that can specifically degrade single stranded RNA. Ribonuclease T1 can form nucleoside 2 ', 3 '-cyclic phosphoric acid intermediates to cut the phosphodiester bond between 3' -guanosine residues and adjacent nucleoside 5 '-OH groups to produce 3' -GMP terminal oligonucleotides .
    Ribonulease T1, Aspergillus oryzae
  • HY-147412
    Ultevursen

    QR-421a

    		 Others Others
    Ultevursen (QR-421a) is a single-stranded RNA based oligonucleotide that is designed to skip exon 13 in the RNA with the aim to stop vision loss in people that have retinitis pigmentosa due to a mutation in exon 13 of the USH2A gene (encoding usherin). Ultevursen sequence: (P-thio)[2′-O-(2-methoxyethyl)](A-G-m 5C-m 5U-m 5U-m 5C-G-G-A-G-A-A-A-m 5U-m 5U-m 5U-A-A-A-m 5U-m 5C) .
    Ultevursen
  • HY-W039442
    2′-Deoxy-2′-fluoroadenosine

    		Nucleoside Antimetabolite/Analog Cancer
    2′-Deoxy-2′-fluoroadenosine can be used for the synthesis of 2′-Deoxy-2′-fluoro-modified oligonucleotides hybridized with RNA. 2′-Deoxy-2′-fluoroadenosine can be cleaved efficiently by E. coli purine nucleoside phosphorylase (PNP) to the toxic agent 2-fluoroadenine (FAde). 2′-Deoxy-2′-fluoroadenosine shows excellent in vivo activity against tumors expressing E. coli PNP .
    2′-Deoxy-2′-fluoroadenosine
  • HY-160222
    HSV-60mer sodium

    		HSV STING Infection Inflammation/Immunology
    HSV-60mer sodium is a 60 bp double-stranded oligonucleotide containing viral DNA motifs that derive from the herpes simplex virus 1 (HSV-1) genome . Transfected HSV-60 has been shown to potently induce IFN-β in a Toll-like receptor (TLR)-, DNA-dependent activator of IRFs (DAI)-, and RNA polymerase III (Pol III)-independent, but STING-, TBK1- and IFN regulatory factor 3 (IRF3)-dependent manner.
    HSV-60mer sodium

Inquiry Online

Your information is safe with us. * Required Fields.

Salutation

  

Country or Region *

Applicant Name *

 

Organization Name *

Department *

     

Email Address *

 

Product Name *

Cat. No.

  

Requested quantity *

Phone Number *

     

Remarks

Inquiry Online

Inquiry Information

Product Name:
Cat. No.:
Quantity:
MCE Japan Authorized Agent: